Mature sequence dre-miR-429a

Accession numberMIMAT0001624
IDdre-miR-429a
Previous IDsdre-miR-429
Stem-Loop dre-mir-429a
Sequence
uaauacugucugguaaugccgu
Get sequence
Deep sequencing33331 reads, 11 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:15891114 "Clustering and conservation patterns of human microRNAs" Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H Nucleic Acids Res. 33:2697-2706(2005).