Mature sequence osa-miR439i

Accession numberMIMAT0001598
IDosa-miR439i
Previous IDsosa-MIR439j
Stem-Loop osa-MIR439i
Sequence
ugucgaaccgcgguuguucga
Get sequence
Deep sequencing11 reads, 2 experiments

References

1
PMID:15805478 "Cloning and characterization of microRNAs from rice" Sunkar R, Girke T, Jain PK, Zhu JK Plant Cell. 17:1397-1411(2005).