Mature sequence osa-miR439h

Accession numberMIMAT0001596
IDosa-miR439h
Previous IDsosa-MIR439h
Stem-Loop osa-MIR439h
Sequence
ugucgaaccgcgguuguucga
Get sequence
Deep sequencing74 reads, 2 experiments
Database links
QuickGO function

References

1
PMID:15805478 "Cloning and characterization of microRNAs from rice" Sunkar R, Girke T, Jain PK, Zhu JK Plant Cell. 17:1397-1411(2005).