Mature sequence osa-miR438

Accession numberMIMAT0001587
IDosa-miR438
Previous IDsosa-MIR438
Stem-Loop osa-MIR438
Sequence
uucccacgcguuauagugaaa
Get sequence
Deep sequencing reads, experiments

References

1
PMID:15805478 "Cloning and characterization of microRNAs from rice" Sunkar R, Girke T, Jain PK, Zhu JK Plant Cell. 17:1397-1411(2005).