Mature sequence hsa-miR-429

• Accession number: MIMAT0001536
• ID: hsa-miR-429
• Stem-Loop: hsa-mir-429
• Sequence: uaauacugucugguaaaaccgu
• Deep sequencing: 200286 reads, 134 experiments
• Database links:
  • RNAcentral:URS000055BBE5_9606
• Predicted targets:
  • TargetMiner:hsa-miR-429
  • TargetScanVert:hsa-miR-429
  • miRDB:hsa-miR-429
  • microrna.org:hsa-miR-429

References

1. PMID:15735639 "Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals" Xie X, Lu J, Kulbokas EJ, Golub TR, Mootha V, Lindblad-Toh K, Lander ES, Kellis M Nature. 434:338-345(2005).
2. PMID:15891114 "Clustering and conservation patterns of human microRNAs" Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H Nucleic Acids Res. 33:2697-2706(2005).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).