Mature sequence hsa-miR-448

Accession numberMIMAT0001532
IDhsa-miR-448
Stem-Loop hsa-mir-448
Sequence
uugcauauguaggaugucccau
Get sequence
Deep sequencing89 reads, 23 experiments
Predicted targets

References

1
PMID:15735639 "Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals" Xie X, Lu J, Kulbokas EJ, Golub TR, Mootha V, Lindblad-Toh K, Lander ES, Kellis M Nature. 434:338-345(2005).