Mature sequence aga-miR-9b

Accession numberMIMAT0001529
IDaga-miR-9b
Stem-Loop aga-mir-9b
Sequence
acuuuggugauuuuagcuguaug
Get sequence
Deep sequencing reads, experiments

References