Mature sequence aga-miR-133

Accession numberMIMAT0001501
IDaga-miR-133
Stem-Loop aga-mir-133
Sequence
uugguccccuucaaccagcugu
Get sequence
Deep sequencing reads, experiments

References