Mature sequence aga-miR-100

Accession numberMIMAT0001498
IDaga-miR-100
Stem-Loop aga-mir-100
Sequence
aacccguagauccgaacuugug
Get sequence
Deep sequencing reads, experiments

References