Mature sequence sbi-miR319a

Accession numberMIMAT0001469
IDsbi-miR319a
Previous IDssbi-MIR319;sbi-miR319
Stem-Loop sbi-MIR319a
Sequence
uuggacugaagggugcuccc
Get sequence
Deep sequencing reads, experiments

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).