Mature sequence sbi-miR169f

Accession numberMIMAT0001456
IDsbi-miR169f
Previous IDssbi-MIR169f
Stem-Loop sbi-MIR169f
Sequence
uagccaaggaugacuugccug
Get sequence
Deep sequencing reads, experiments

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).