Mature sequence sbi-miR395a

Accession numberMIMAT0001430
IDsbi-miR395a
Previous IDssbi-MIR395a
Stem-Loop sbi-MIR395a
Sequence
gugaaguguuugggggaacuc
Get sequence
Deep sequencing reads, experiments

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).