Mature sequence sbi-miR164a

Accession numberMIMAT0001406
IDsbi-miR164a
Previous IDssbi-miR164
Stem-Loop sbi-MIR164a
Sequence
uggagaagcagggcacgugca
Get sequence
Deep sequencing reads, experiments

References

1
"Identifying microRNAs in plant genomes" Maher C, Timmermans M, Stein L, Ware D Proc IEEE CSB :718-723(2004).
2
PMID:15660154 "Sorghum genome sequencing by methylation filtration" Bedell JA, Budiman MA, Nunberg A, Citek RW, Robbins D, Jones J, Flick E, Rholfing T, Fries J, Bradford K, McMenamy J, Smith M, Holeman H, Roe BA, Wiley G, Korf IF, Rabinowicz PD, Lakey N, McCombie WR, Jeddeloh JA, Martienssen RA PLoS Biol. 3:e13(2005).