Mature sequence zma-miR156b-5p

• Accession number: MIMAT0001354
• ID: zma-miR156b-5p
• Previous IDs: zma-miR156b
• Stem-Loop: zma-MIR156b
• Sequence: ugacagaagagagugagcac
• Deep sequencing: 222547 reads, 217 experiments
• Database links:
  • RNAcentral:URS000020F5A7_4577

References

1. "Identifying microRNAs in plant genomes" Maher C, Timmermans M, Stein L, Ware D Proc IEEE CSB :718-723(2004).
2. PMID:15916721 "Identification and characterization of new plant microRNAs using EST analysis" Zhang BH, Pan XP, Wang QL, Cobb GP, Anderson TA Cell Res. 15:336-360(2005).
3. PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).