Mature sequence cbr-miR-357

Accession numberMIMAT0001298
IDcbr-miR-357
Stem-Loop cbr-mir-357-1 cbr-mir-357-2
Sequence
aaaaugccagucauugacgga
Get sequence
Deep sequencing reads, experiments

References

1