Mature sequence dre-miR-181a-3p

Accession numberMIMAT0001282
IDdre-miR-181a-3p
Previous IDsdre-miR-213;dre-miR-181a*
Stem-Loop dre-mir-181a-1
Sequence
accaucgaccguugauuguacc
Get sequence
Deep sequencing17500 reads, 11 experiments
Database links
QuickGO function

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).