Mature sequence dre-miR-203a-3p

Accession numberMIMAT0001278
IDdre-miR-203a-3p
Previous IDsdre-miR-203a
Stem-Loop dre-mir-203a
Sequence
gugaaauguuuaggaccacuug
Get sequence
Deep sequencing372442 reads, 11 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).