Mature sequence dre-miR-7b

Accession numberMIMAT0001265
IDdre-miR-7b
Stem-Loop dre-mir-7b
Sequence
uggaagacuugugauuuuguu
Get sequence
Deep sequencing3707 reads, 11 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).