Mature sequence dps-miR-287

Accession numberMIMAT0001251
IDdps-miR-287
Stem-Loop dps-mir-287
Sequence
uguguugaaaaucguuugcac
Get sequence
Deep sequencing reads, experiments

References