Mature sequence dps-miR-277

Accession numberMIMAT0001241
IDdps-miR-277
Stem-Loop dps-mir-277
Sequence
uaaaugcacuaucugguacgaca
Get sequence
Deep sequencing reads, experiments

References