Mature sequence dps-miR-124

Accession numberMIMAT0001229
IDdps-miR-124
Stem-Loop dps-mir-124
Sequence
uaaggcacgcggugaaugccaag
Get sequence
Deep sequencing reads, experiments

References