Mature sequence dps-miR-100

Accession numberMIMAT0001228
IDdps-miR-100
Stem-Loop dps-mir-100
Sequence
aacccguaauuccgaacuugug
Get sequence
Deep sequencing reads, experiments

References