Mature sequence dps-miR-79

Accession numberMIMAT0001224
IDdps-miR-79
Stem-Loop dps-mir-79
Sequence
uaaagcuagauuaccaaagcau
Get sequence
Deep sequencing reads, experiments

References