Mature sequence dps-miR-13a

Accession numberMIMAT0001217
IDdps-miR-13a
Stem-Loop dps-mir-13a
Sequence
uaucacagccauuuugaugagu
Get sequence
Deep sequencing reads, experiments

References