Mature sequence dps-miR-4

Accession numberMIMAT0001204
IDdps-miR-4
Stem-Loop dps-mir-4
Sequence
auaaagcuagacaaccauuga
Get sequence
Deep sequencing reads, experiments

References