Mature sequence dps-miR-2c

Accession numberMIMAT0001202
IDdps-miR-2c
Stem-Loop dps-mir-2c
Sequence
uaucacagccagcuuugaugggc
Get sequence
Deep sequencing reads, experiments

References