Mature sequence dps-bantam

Accession numberMIMAT0001197
IDdps-bantam
Stem-Loop dps-bantam
Sequence
ugagaucauuuugaaagcugauu
Get sequence
Deep sequencing reads, experiments

References