Mature sequence gga-miR-9-5p

• Accession number: MIMAT0001195
• ID: gga-miR-9-5p
• Previous IDs: gga-miR-9
• Stem-Loop: gga-mir-9-2 gga-mir-9-1 gga-mir-9-3 gga-mir-9-4
• Sequence: ucuuugguuaucuagcuguauga
• Deep sequencing: 23818269 reads, 5 experiments

References

1. PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2. PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).
3. PMID:26473382 "A Uniform System for the Annotation of Vertebrate microRNA Genes and the Evolution of the Human microRNAome" Fromm B, Billipp T, Peck LE, Johansen M, Tarver JE, King BL, Newcomb JM, Sempere LF, Flatmark K, Hovig E, Peterson KJ Annu Rev Genet. 49:213-242(2015).