Mature sequence gga-miR-183

Accession numberMIMAT0001191
IDgga-miR-183
Stem-Loop gga-mir-183
Sequence
uauggcacugguagaauucacug
Get sequence
Deep sequencing9113 reads, 5 experiments
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).