Mature sequence gga-miR-219a

Accession numberMIMAT0001170
IDgga-miR-219a
Stem-Loop gga-mir-219a
Sequence
ugauuguccaaacgcaauucu
Get sequence
Deep sequencing664 reads, 4 experiments
Predicted targets

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).