Mature sequence gga-let-7b

Accession numberMIMAT0001102
IDgga-let-7b
Stem-Loop gga-let-7b
Sequence
ugagguaguagguugugugguu
Get sequence
Deep sequencing8829103 reads, 5 experiments
Database links
Predicted targets
QuickGO function

References

1
" McBride D, Carre W, Law A, Clinton M Unpublished.
2
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).