Mature sequence osa-miR171i-3p

Accession numberMIMAT0001085
IDosa-miR171i-3p
Previous IDsosa-miR171i
Stem-Loop osa-MIR171i
Sequence
ggauugagccgcgucaauauc
Get sequence
Deep sequencing64 reads, 2 experiments
Database links
QuickGO function

References

1
2
PMID:21901091 "Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors" Du P, Wu J, Zhang J, Zhao S, Zheng H, Gao G, Wei L, Li Y PLoS Pathog. 7:e1002176(2011).