Mature sequence osa-miR393b-5p

• Accession number: MIMAT0001078
• ID: osa-miR393b-5p
• Previous IDs: osa-miR393b
• Stem-Loop: osa-MIR393b
• Sequence: uccaaagggaucgcauugaucu
• Deep sequencing: 209 reads, 2 experiments
• Database links:
  • RNAcentral:URS000039C9E6_39947

References

1. PMID:15258262 "Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis" Sunkar R, Zhu JK Plant Cell. 16:2001-2019(2004).
2. PMID:19903869 "Rice MicroRNA effector complexes and targets" Wu L, Zhang Q, Zhou H, Ni F, Wu X, Qi Y Plant Cell. 21:3421-3435(2009).