Mature sequence osa-miR393b-5p

Accession numberMIMAT0001078
IDosa-miR393b-5p
Previous IDsosa-miR393b
Stem-Loop osa-MIR393b
Sequence
uccaaagggaucgcauugaucu
Get sequence
Deep sequencing209 reads, 2 experiments
Database links
QuickGO function

References

1
PMID:15258262 "Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis" Sunkar R, Zhu JK Plant Cell. 16:2001-2019(2004).
2
PMID:19903869 "Rice MicroRNA effector complexes and targets" Wu L, Zhang Q, Zhou H, Ni F, Wu X, Qi Y Plant Cell. 21:3421-3435(2009).