Mature sequence osa-miR171b

Accession numberMIMAT0001063
IDosa-miR171b
Stem-Loop osa-MIR171b
Sequence
ugauugagccgugccaauauc
Get sequence
Deep sequencing545 reads, 2 experiments
Database links
QuickGO function

References

1