Mature sequence osa-miR167g

Accession numberMIMAT0001042
IDosa-miR167g
Stem-Loop osa-MIR167g
Sequence
ugaagcugccagcaugaucug
Get sequence
Deep sequencing86978 reads, 2 experiments
Database links
QuickGO function

References

1