Mature sequence osa-miR167f

Accession numberMIMAT0001041
IDosa-miR167f
Stem-Loop osa-MIR167f
Sequence
ugaagcugccagcaugaucug
Get sequence
Deep sequencing86976 reads, 2 experiments
Database links
QuickGO function

References

1