Mature sequence ath-miR167c-5p

Accession numberMIMAT0001018
IDath-miR167c-5p
Previous IDsath-miR167c
Stem-Loop ath-MIR167c
Sequence
uaagcugccagcaugaucuug
Get sequence
Deep sequencing reads, experiments

References

1
2
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
3
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).