Mature sequence osa-miR394

Accession numberMIMAT0000958
IDosa-miR394
Stem-Loop osa-MIR394
Sequence
uuggcauucuguccaccucc
Get sequence
Deep sequencing123 reads, 2 experiments
Database links
QuickGO function

References

1