Mature sequence rno-miR-183-5p

Accession numberMIMAT0000860
IDrno-miR-183-5p
Previous IDsrno-miR-183
Stem-Loop rno-mir-183
Sequence
uauggcacugguagaauucacu
Get sequence
Deep sequencing544845 reads, 493 experiments
Predicted targets

References

1
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).