Mature sequence rno-miR-126a-5p

• Accession number: MIMAT0000831
• ID: rno-miR-126a-5p
• Previous IDs: rno-miR-126*
• Stem-Loop: rno-mir-126a
• Sequence: cauuauuacuuuugguacgcg
• Deep sequencing: 5665621 reads, 495 experiments
• Predicted targets:
  • TargetScanVert:rno-miR-126a-5p
  • miRDB:rno-miR-126a-5p
  • microrna.org:rno-miR-126a-5p

References

1. PMID:16766679 "Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes" Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H Genes Dev. 20:1732-1743(2006).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3. PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).