Mature sequence hsa-miR-346

• Accession number: MIMAT0000773
• ID: hsa-miR-346
• Stem-Loop: hsa-mir-346
• Sequence: ugucugcccgcaugccugccucu
• Deep sequencing: 857 reads, 96 experiments
• Database links:
  • RNAcentral:URS0000134ADC_9606
• Predicted targets:
  • TargetMiner:hsa-miR-346
  • TargetScanVert:hsa-miR-346
  • miRDB:hsa-miR-346
  • microrna.org:hsa-miR-346

References

1. PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2. PMID:15634332 "New human and mouse microRNA genes found by homology search" Weber MJ FEBS J. 272:59-73(2005).