Mature sequence cbr-lsy-6

Accession numberMIMAT0000767
IDcbr-lsy-6
Stem-Loop cbr-lsy-6
Sequence
uuuuguaugagacgcauuccg
Get sequence
Deep sequencing reads, experiments

References

1
2