Mature hsa-miR-135b-5p
| Accession | MIMAT0000758 |
| Description | hsa-miR-135b-5p mature miRNA |
| Hairpins | |
| Sequence | UAUGGCUUUUCAUUCCUAUGUGA |
| Evidence |
experimental
cloned [3-4] |
| Database links |
|
| Predicted targets |
|
QuickGo Function
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
| Qualifier | GO term | Evidence | Reference | Annotation Extension |
|---|---|---|---|---|
| acts_upstream_of | GO:0010629 negative regulation of gene expression |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23594704 | has_input UniProtKB:P04637 |
| enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23594704 | has_input UniProtKB:Q13362 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23594704 | has_input UniProtKB:Q13362 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24802670 | has_input UniProtKB:P36897 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26184978 | has_input UniProtKB:O00409 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26184978 | has_input UniProtKB:Q06413 |
| involved_in | GO:0007399 nervous system development |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:24802670 | occurs_in CL:0002322 |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23594704 | has_input UniProtKB:Q13362 |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26184978 | has_input UniProtKB:O00409 |
| involved_in | GO:0035278 miRNA-mediated gene silencing by inhibition of translation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24802670 | has_input UniProtKB:P36897 |
| involved_in | GO:0035278 miRNA-mediated gene silencing by inhibition of translation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26184978 | has_input UniProtKB:Q06413 |
| involved_in | GO:0035279 miRNA-mediated gene silencing by mRNA destabilization |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27793001 | has_input UniProtKB:Q8WY54 |
| involved_in | GO:0043536 positive regulation of blood vessel endothelial cell migration |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26184978 | results_in_movement_of CL:0002618 |
| involved_in | GO:1904707 positive regulation of vascular associated smooth muscle cell proliferation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26184978 | results_in_division_of CL:0002539 |
| involved_in | GO:1904754 positive regulation of vascular associated smooth muscle cell migration |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26184978 | results_in_movement_of CL:0002539 |
| involved_in | GO:1905564 positive regulation of vascular endothelial cell proliferation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26184978 | results_in_division_of CL:0002618 |
StarBase
MicroRNA-mRNA interaction maps from Argonaute CLIP-Seq and Degradome-Seq data.
| Target Gene ID | Target Gene Name | Number of supporting experiments | Number of target-predicting programs | Maximum number of target sites | Chromosome | Target-predicting region start | Target-predicting region end | Strand |
|---|
miR2Disease
A manually curated database, aimed at providing a comprehensive resource of miRNA deregulation in various human diseases.
Click here for more information and to obtain references for the studies.
| Disease | Differential expression | Experiment | Year | Study |
|---|
