Mature sequence hsa-miR-151a-3p

• Accession number: MIMAT0000757
• ID: hsa-miR-151a-3p
• Previous IDs: hsa-miR-151;hsa-miR-151-3p
• Stem-Loop: hsa-mir-151a
• Sequence: cuagacugaagcuccuugagg
• Deep sequencing: 684519 reads, 159 experiments
• Database links:
  • RNAcentral:URS000016C318_9606
• Predicted targets:
  • TargetMiner:hsa-miR-151a-3p
  • TargetScanVert:hsa-miR-151a-3p
  • miRDB:hsa-miR-151a-3p
  • microrna.org:hsa-miR-151a-3p

References

1. PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2. PMID:15634332 "New human and mouse microRNA genes found by homology search" Weber MJ FEBS J. 272:59-73(2005).
3. PMID:15978578 "Identification of human fetal liver miRNAs by a novel method" Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
4. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).