Mature sequence cel-lsy-6-3p

Accession numberMIMAT0000749
IDcel-lsy-6-3p
Previous IDscel-lsy-6
Stem-Loop cel-lsy-6
Sequence
uuuuguaugagacgcauuucga
Get sequence
Deep sequencing494 reads, 17 experiments
Database links
Predicted targets
QuickGO function

References

1
2
3
4
PMID:21085120 "Formation, regulation and evolution of Caenorhabditis elegans 3'UTRs" Jan CH, Friedman RC, Ruby JG, Bartel DP Nature. 469:97-101(2011).