Accession | MIMAT0000743 |
Description | mmu-miR-379-5p mature miRNA |
Hairpins | |
Sequence | UGGUAGACUAUGGAACGUAGG |
Evidence |
experimental
cloned [1-4], Illumina [5,7] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25510864 | has_input UniProtKB:P35951 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25510864 | has_input UniProtKB:Q99KG5 |
involved_in | GO:0032868 response to insulin |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:25510864 | occurs_in UBERON:0002107 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25510864 | has_input UniProtKB:Q99KG5 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25510864 | occurs_in UBERON:0002107 |
involved_in | GO:0070328 triglyceride homeostasis |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:25510864 | occurs_in UBERON:0001969 |
involved_in | GO:0110119 positive regulation of very-low-density lipoprotein particle clearance |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:25510864 | occurs_in UBERON:0002107 |