Accession | MIMAT0000739 |
Description | mmu-miR-375-3p mature miRNA |
Hairpins | |
Sequence | UUUGUUCGUUCGGCUCGCGUGA |
Evidence |
experimental
cloned [1-2], Illumina [3-4] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26235810 | has_input UniProtKB:Q9Z2A0 |
involved_in | GO:0010666 positive regulation of cardiac muscle cell apoptotic process |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:26235810 | occurs_in CL:0000746 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26235810 | has_input UniProtKB:Q9Z2A0 |
involved_in | GO:0051898 negative regulation of phosphatidylinositol 3-kinase/protein kinase B signal transduction |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26235810 | occurs_in CL:0010004 |
involved_in | GO:0071345 cellular response to cytokine stimulus |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26235810 | occurs_in CL:0010004 |
involved_in | GO:1903671 negative regulation of sprouting angiogenesis |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26235810 | occurs_in CL:0002619 |