Mature hsa-miR-376c-3p

• Accession: MIMAT0000720
• Description: hsa-miR-376c-3p mature miRNA
• Hairpins:
  • hsa-mir-376c
• Sequence: AACAUAGAGGAAAUUCCACGU
• Evidence: experimental ; cloned [1-2,4], Northern [1], SOLiD [5]

QuickGo Function

QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.

Qualifier	GO term	Evidence	Reference	Annotation Extension
acts_upstream_of	GO:0030335 positive regulation of cell migration	ECO:0000315 mutant phenotype evidence used in manual assertion	PMID:23424236	occurs_in CL:0000351
acts_upstream_of	GO:0030512 negative regulation of transforming growth factor beta receptor signaling pathway	ECO:0000315 mutant phenotype evidence used in manual assertion	PMID:23424236	occurs_in CL:0000351
acts_upstream_of	GO:1903845 negative regulation of cellular response to transforming growth factor beta stimulus	ECO:0000315 mutant phenotype evidence used in manual assertion	PMID:23424236	occurs_in CL:0000351
acts_upstream_of	GO:1903845 negative regulation of cellular response to transforming growth factor beta stimulus	ECO:0000315 mutant phenotype evidence used in manual assertion	PMID:23424236	occurs_in CL:0000351
enables	GO:1903231 mRNA base-pairing translational repressor activity	ECO:0000315 mutant phenotype evidence used in manual assertion	PMID:23424236	has_input UniProtKB:Q8NER5
involved_in	GO:0035195 miRNA-mediated post-transcriptional gene silencing	ECO:0000315 mutant phenotype evidence used in manual assertion	PMID:23424236	occurs_in CL:0000351
located_in	GO:0005615 extracellular space	ECO:0007005 high throughput direct assay evidence used in manual assertion	PMID:26646931	part_of UBERON:0001969