Mature sequence hsa-miR-376c-3p

• Accession number: MIMAT0000720
• ID: hsa-miR-376c-3p
• Previous IDs: hsa-miR-368;hsa-miR-376c
• Stem-Loop: hsa-mir-376c
• Sequence: aacauagaggaaauuccacgu
• Deep sequencing: 33338 reads, 132 experiments
• Database links:
  • RNAcentral:URS00005E651E_9606
• Predicted targets:
  • TargetScanVert:hsa-miR-376c-3p
  • miRDB:hsa-miR-376c-3p
  • microrna.org:hsa-miR-376c-3p

References

1. PMID:15183728 "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
2. PMID:15891114 "Clustering and conservation patterns of human microRNAs" Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H Nucleic Acids Res. 33:2697-2706(2005).
3. PMID:17322061 "Redirection of silencing targets by adenosine-to-inosine editing of miRNAs" Kawahara Y, Zinshteyn B, Sethupathy P, Iizasa H, Hatzigeorgiou AG, Nishikura K Science. 315:1137-1140(2007).
4. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5. PMID:22282338 "Deep-sequencing of endothelial cells exposed to hypoxia reveals the complexity of known and novel microRNAs" Voellenkle C, Rooij Jv, Guffanti A, Brini E, Fasanaro P, Isaia E, Croft L, David M, Capogrossi MC, Moles A, Felsani A, Martelli F RNA. 18:472-484(2012).