Mature hsa-miR-361-5p
| Accession | MIMAT0000703 |
| Description | hsa-miR-361-5p mature miRNA |
| Hairpins | |
| Sequence | UUAUCAGAAUCUCCAGGGGUAC |
| Evidence |
experimental
cloned [2] |
| Database links |
|
| Predicted targets |
|
QuickGo Function
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
| Qualifier | GO term | Evidence | Reference | Annotation Extension |
|---|---|---|---|---|
| enables | GO:0106222 lncRNA binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:31694982 | |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24865854 | has_input UniProtKB:P15692 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28444107 | has_input UniProtKB:P06858 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:31694982 | has_input UniProtKB:P01137 |
| involved_in | GO:0016525 negative regulation of angiogenesis |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:25203061 | occurs_in CL:0000071 |
| involved_in | GO:0030512 negative regulation of transforming growth factor beta receptor signaling pathway |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:31694982 | has_input UniProtKB:P01137 |
| involved_in | GO:0032651 regulation of interleukin-1 beta production |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28444107 | occurs_in CL:0000517 |
| involved_in | GO:0032675 regulation of interleukin-6 production |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28444107 | occurs_in CL:0000517 |
| involved_in | GO:0032680 regulation of tumor necrosis factor production |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28444107 | occurs_in CL:0000517 |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24865854 | has_input UniProtKB:P15692 |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28444107 | has_input UniProtKB:P06858 |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:31694982 | has_input UniProtKB:P01137 |
| involved_in | GO:0050727 regulation of inflammatory response |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28444107 | occurs_in CL:0000517 |
| involved_in | GO:0090051 negative regulation of cell migration involved in sprouting angiogenesis |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24865854 | occurs_in CL:0002619 |
| involved_in | GO:1903588 negative regulation of blood vessel endothelial cell proliferation involved in sprouting angiogenesis |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24865854 | occurs_in CL:0002619 |
| involved_in | GO:1904046 negative regulation of vascular endothelial growth factor production |
ECO:0007001 high throughput mutant phenotypic evidence used in manual assertion |
PMID:18320040 | |
| located_in | GO:0005615 extracellular space |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25203061 | part_of UBERON:0001969 |
| located_in | GO:0005615 extracellular space |
ECO:0007005 high throughput direct assay evidence used in manual assertion |
PMID:26646931 | part_of UBERON:0001969 |
StarBase
MicroRNA-mRNA interaction maps from Argonaute CLIP-Seq and Degradome-Seq data.
| Target Gene ID | Target Gene Name | Number of supporting experiments | Number of target-predicting programs | Maximum number of target sites | Chromosome | Target-predicting region start | Target-predicting region end | Strand |
|---|
miR2Disease
A manually curated database, aimed at providing a comprehensive resource of miRNA deregulation in various human diseases.
Click here for more information and to obtain references for the studies.
| Disease | Differential expression | Experiment | Year | Study |
|---|
