Accession | MIMAT0000658 |
Description | mmu-miR-210-3p mature miRNA |
Hairpins | |
Sequence | CUGUGCGUGUGACAGCGGCUGA |
Evidence |
experimental
cloned [2,4], Illumina [5,7] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:26708520 | occurs_in CL:1001451 |
involved_in | GO:0010977 negative regulation of neuron projection development |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:26708520 | occurs_in CL:1001451 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:26708520 | occurs_in CL:1001451 |
involved_in | GO:2001235 positive regulation of apoptotic signaling pathway |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:26708520 | occurs_in CL:1001451 |